Re: Optimization algorithm help needed

On Aug 14, 1:54 pm, Bryan <b...@xxxxxxxxxx> wrote:
Hi,

I'm doing a little bioinformatics work, and could use some advice on a
problem. Im posting it here becuase it really is an optimization issue
(I think).

Given a sequence, I can design multiple sets of primers that will
amplify parts of this sequence with PCR. The region of the sequence
amplified between the primers is the product.

So I might have something like this:

Seq: AAGGGCCTTTGGAAGGGCCCTGCGGTTCTCTAAGGCCGCGGCTTTA
P1 >>>> <<<<<
P2 >>>> <<<<<
P3 >>>>> <<<<
P4 >>>> <<<<<<<
P5 >>>> <<<<
P6 >>> <<<<

So, here's where the optimization starts... each primer set (P1-P6) is
ranked by a score as to how well it will work with the PCR. I also
need to favor longer products, as these primers cost money and the less
of them I have to order the better. I also need to cover the entire
sequence with primers.

So is there a way to pick the ideal set of primers, optimizing for:
1. Score
2. Length
3. Coverage

I think this is not an unusual problem, maybe there are papers that do
something like this? Or maybe even exactly this?

Maybe more info is needed?

Yes. A lot more information about your problem is needed.

1. Is the sequence fixed? You want to design a set of "primers"
which is optimum for this sequence?

2. You've explained almost nothing about what a "primer"
does. I'm guessing that it is something that looks for
a specific sequence and snips the part between two
occurrences of that sequence.
a. Is that correct?
b. Is the number of primers fixed?
c. Is the length of the sequence a primer looks
for fixed?
d. What if there were n copies of that sequence?
Would the primer snip the whole strand into (n-1)
substrands at those points?

3. What do you mean by coverage? If the effect of
P1 (for instance) in your drawing above is to snip
the sequence into 3 pieces, don't those 3 pieces
cover pretty much the whole strand?

4. What is PCR and what does "how well it works with
the PCR" mean?

Probably lots more questions based on your answers,
but that's what looks to me like the most basic
missing info.

- Randy

.

Relevant Pages

  • Optimization algorithm help needed
    ... I'm doing a little bioinformatics work, and could use some advice on a problem. ... Im posting it here becuase it really is an optimization issue. ... Given a sequence, I can design multiple sets of primers that will amplify parts of this sequence with PCR. ...
    (sci.math)
  • Re: Optimization algorithm help needed
    ... I'm doing a little bioinformatics work, and could use some advice on a ... Given a sequence, I can design multiple sets of primers that will ... here's where the optimization starts... ...
    (sci.math)
  • Re: Optimization algorithm help needed
    ... I just started with python, and have a for loop question ... Im posting it here becuase it really is an optimization issue. ... Given a sequence, I can design multiple sets of primers that will amplify parts of this sequence with PCR. ...
    (sci.math)
  • Re: Optimization algorithm help needed
    ... a specific sequence and snips the part between two ... No. Primers are pairs of short DNA sequences which will amplify the sequence of DNA between them in PCR. ... Would the primer snip the whole strand into ... P1 in your drawing above is to snip ...
    (sci.math)
  • Re: Envelope Optimization and Control Using Fuzzy Logic
    ... The basic building tool for envelope optimization is the fuzzy logic Envelope Controller function block. ... Each EC in the chain sequence focuses on a single process variable, with the complete chain forming an efficient and sophisticated optimization strategy. ...
    (sci.engr.control)
Quantcast